Skip to content

Instantly share code, notes, and snippets.

@kclem
Last active October 7, 2022 19:54
Show Gist options
  • Select an option

  • Save kclem/57c2380d4c1802ec8bf0f8d3927bc4f5 to your computer and use it in GitHub Desktop.

Select an option

Save kclem/57c2380d4c1802ec8bf0f8d3927bc4f5 to your computer and use it in GitHub Desktop.
Simulate paired reads with adapter readthrough and substitutions for testing adapter trimming and read merging
import random
simulate_deletion_lens = range(30) #deletions to simulate - here, 0 to 30bp deletions. The longer the deletion, the more adapter will be included in the read
simulate_mismatch_counts = range(3) #number of mismatches to simulate - her, 0, 1, and 2 mismatches between r1 and r2. The higher the number of mismatches, the less likely the read will be merged.
read_len = 210 #length of reads to generate
read = ' CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG '
readthrough = 'ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
complement = {'A': 'T', 'C': 'G', 'G': 'C', 'T': 'A'}
def rev_comp(seq):
bases = list(seq)
bases = [complement[base] for base in bases]
return ''.join(bases[::-1])
start_spaces = 0
for i in range(len(read)):
if read[i] == ' ':
start_spaces += 1
else:
break
end_spaces = 0
for i in range(len(read)-1,0,-1):
if read[i] == ' ':
end_spaces += 1
else:
break
indel_loc = 80 + start_spaces
print(f"5' adapter length: {start_spaces}")
print(f"3' adapter length: {end_spaces}")
end_loc = len(readthrough)-end_spaces
#with 210 read length, any more than 13bp deletion will result in adapter readthrough
max_indel_no_adapter = len(read.replace(' ','')) - read_len
print(f'Only reads with deletions longer than {max_indel_no_adapter}bp will have adapter readthrough')
print('Starting simulation')
file_root = 'makeSims.py.read_length_'+str(read_len)
read_id = 0
with open(file_root+".r1.fq",'w') as f1out, open(file_root+".r2.fq",'w') as f2out:
for indel_len in simulate_deletion_lens:
for num_mismatches in simulate_mismatch_counts:
readthrough_copy = readthrough[0:indel_loc] + readthrough[indel_loc+indel_len:]
copy_end_loc = len(readthrough_copy)-end_spaces
sim_read1 = readthrough_copy[start_spaces:start_spaces+read_len]
sim_read2 = readthrough_copy[copy_end_loc-read_len:copy_end_loc]
sim_read2 = rev_comp(sim_read2)
sub_locs = random.sample(range(len(sim_read2)),num_mismatches)
for sub_loc in sub_locs:
sim_read2 = sim_read2[0:sub_loc]+complement[sim_read2[sub_loc]] + sim_read2[sub_loc+1:]
expected_adapter_len = max(0,indel_len-max_indel_no_adapter) #how much adapter will be at the end of the read
this_id = f'@sim_read_{read_id}__indel_len_{indel_len}__expected_adapter_{expected_adapter_len}__sub_locs_'+','.join([str(x) for x in sub_locs])
this_qual = 'A'*len(sim_read1)
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n')
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n')
read_id += 1
print(f'Finished. Printed {read_id} simulations.')
print('Writing single-end file with trimming required')
read_id = 0
with open(file_root+".single_end_trim_reqd.r1.fq",'w') as f1out:
for i in range(100):
random_bases = ''.join(random.choices(nucleotides,k=5))
sim_read1 = readthrough[start_spaces:] + random_bases
this_id = f'@sim_read_{read_id}'
this_qual = 'H'*len(sim_read1)
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n')
read_id += 1
print('Finished')
print('Writing paired-end file with trimming required')
read_id = 0
with open(file_root+".paired_end_trim_reqd.r1.fq",'w') as f1out, open(file_root+".paired_end_trim_reqd.r2.fq",'w') as f2out:
for i in range(100):
random_bases = ''.join(random.choices(nucleotides,k=5))
sim_read1 = readthrough[start_spaces:] + random_bases
copy_end_loc = len(readthrough)-end_spaces
sim_read2 = readthrough[0:copy_end_loc]
random_bases = ''.join(random.choices(nucleotides,k=5))
sim_read2 = rev_comp(sim_read2) + random_bases
this_id = f'@sim_read_{read_id}'
this_qual = 'H'*len(sim_read1)
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n')
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n')
read_id += 1
print('Finished')
print('Writing paired-end file with merging required')
read_id = 0
with open(file_root+".paired_end_merge_reqd.r1.fq",'w') as f1out, open(file_root+".paired_end_merge_reqd.r2.fq",'w') as f2out:
for i in range(100):
sim_read1 = readthrough[start_spaces:start_spaces+read_len]
copy_end_loc = len(readthrough)-end_spaces
sim_read2 = readthrough[copy_end_loc-read_len:copy_end_loc]
sim_read2 = rev_comp(sim_read2)
this_id = f'@sim_read_{read_id}'
this_qual = 'H'*len(sim_read1)
f1out.write(f'{this_id}\n{sim_read1}\n+\n{this_qual}\n')
f2out.write(f'{this_id}\n{sim_read2}\n+\n{this_qual}\n')
read_id += 1
print('Finished')
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment