Colelyman’s gists

Colelyman / qwc.py

Created November 3, 2025 21:57

Extract Quantification Windows from CRISPResso Runs

	"""Report the quantification window indexes used from a CRISPResso run.

	The script expects to be adjacent to any number of CRISPResso runs, it will
	search among the runs and extract each CRISPResso2_info.json file and print
	out the quantification windows for each amplicon.
	"""
	import glob
	import json

Colelyman / simPairedReadsWithAdapter.py

Created October 7, 2022 19:54 — forked from kclem/simPairedReadsWithAdapter.py

Simulate paired reads with adapter readthrough and substitutions for testing adapter trimming and read merging

	import random

	simulate_deletion_lens = range(30) #deletions to simulate - here, 0 to 30bp deletions. The longer the deletion, the more adapter will be included in the read
	simulate_mismatch_counts = range(3) #number of mismatches to simulate - her, 0, 1, and 2 mismatches between r1 and r2. The higher the number of mismatches, the less likely the read will be merged.
	read_len = 210 #length of reads to generate

	read = ' CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG '
	readthrough = 'ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGGAGATCGGAAGAGCACACGTCTGAACTCCAGTC

Colelyman / eulerian_path.py

Created January 2, 2021 18:16

Discover an Eulerian Path from a Graph.

	"""Discover an Eulerian Path from a graph."""

	import argparse
	from collections import Counter
	from typing import Dict, List, Optional


	def construct_graph_from_adjacency(
	graph_file_path: str,
	) -> Dict[str, List[str]]:

Colelyman / eulerian_cycle.py

Last active January 2, 2021 18:16

Discover an Eulerian Cycle from a graph.

	"""Discover an Eulerian Cycle from a graph."""

	import argparse
	from typing import Dict, List


	def construct_graph_from_adjacency(
	graph_file_path: str,
	) -> Dict[str, List[str]]:
	"""Construct a graph from an adjacency list in `graph_file_path`.

Colelyman / citation

Created December 6, 2019 21:55

Generate a citation in Markdown from a BibTeX entry.

	#!/bin/sh

	TEMP_BIB_PATH=".mybib.bib"
	TEMP_MD_PATH=".mybib.md"
	TEMP_CITATION_PATH=".mycitation.md"

	clean() {
	rm -rf $TEMP_BIB_PATH $TEMP_MD_PATH $TEMP_CITATION_PATH
	}

Colelyman / genomes.txt

Created April 8, 2019 23:30

Colelyman / file-defer-close.lisp

Last active October 23, 2018 03:39

A Common Lisp macro that opens a file and closes it after some computation is done.

	(defmacro open-file-defer-close (file-path file-handle &body body)
	"Opens FILE-PATH as FILE-HANDLE, executes BODY and finally closes FILE-HANDLE."
	`(let ((,file-handle ,(open file-path)))
	,@body
	(close ,file-handle)))

Colelyman / keybase.md

Created August 23, 2018 23:47

I hereby claim:

To claim this, I am signing this object:

Colelyman / install.sh

Created January 2, 2018 21:02

How to link software installed in a custom location using autotools.

	# to be run within your project that is built with autotools (aka has a configure script)
	# replace the text within '<...>' with the respective paths
	export LD_LIBRARY_PATH=<lib directory of the library>:$LD_LIBRARY_PATH

	./configure CPPFLAGS="-I<include directory of the library> -L<lib directory of the library>"

	make CPPFLAGS="-I<include directory of the library> -L<lib directory of the library>" LDFLAGS="-I<include directory of the library> -L<lib directory of the library>"

Colelyman / sbatch_tricks.sh

Created December 9, 2017 07:15

Some tricks for doing cool things with sbatch scripts.

	# start a job after another job succeeds
	JOBID=$(sbatch --parsable job1.sh) && sbatch --dependency=afterok:$JOBID job2.sh

	# start a job after another job fails
	JOBID=$(sbatch --parsable job1.sh) && sbatch --dependency=afternotok:$JOBID job2.sh

	# get the time and memory of a running node
	sstat --format="CPUTime,Elapsed,MaxRSS" -j $SLURM_JOB_ID

Cole Lyman Colelyman