Created
August 16, 2019 05:34
-
-
Save finswimmer/877d678d10ffb35b87e954e74d2f17eb to your computer and use it in GitHub Desktop.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| rule target: | |
| input: | |
| bam = "SRR7526729_realigned.bam", | |
| index = "SRR7526729_realigned.bam.bai" | |
| rule umi_extract: | |
| input: | |
| R1 = "../{sample}_1.fastq.gz", | |
| R2 = "../{sample}_2.fastq.gz" | |
| output: | |
| R1_UMI = "{sample}_1_umi.fastq.gz", | |
| R2_UMI = "{sample}_2_umi.fastq.gz" | |
| log: | |
| "{sample}_umi_extract.log" | |
| shell: | |
| """ | |
| paste <(unpigz -c {input.R1}|paste - - - -) <(unpigz -c {input.R2}|paste - - - -)|mawk -v FS="\\t" -v OFS="\\n" '{{umi = substr($6,1,12); split($1, R1, " "); split($5, R2, " "); print R1[1]"_"umi,$2,$3,$4|"pigz -c > {output.R1_UMI}"; print R2[1]"_"umi,substr($6,24),$7,substr($8,24)|"pigz -c > {output.R2_UMI}"}}' | |
| """ | |
| rule trim_fastq: | |
| input: | |
| R1_UMI = "{sample}_1_umi.fastq.gz", | |
| R2_UMI = "{sample}_2_umi.fastq.gz" | |
| output: | |
| R1_TRIM = temp("{sample}_1_trim.fastq.gz"), | |
| R2_TRIM = temp("{sample}_2_trim.fastq.gz") | |
| shell: | |
| """ | |
| bbmerge.sh in={input.R1_UMI} in2={input.R2_UMI} out={output.R1_TRIM} out2={output.R2_TRIM} adapter=CAAAACGCAATACTGTACATT overwrite=true tbo ecco=t | |
| """ | |
| rule align_sort: | |
| input: | |
| R1_TRIM = "{sample}_1_trim.fastq.gz", | |
| R2_TRIM = "{sample}_2_trim.fastq.gz" | |
| output: | |
| bam = temp("{sample}_alignment.bam") | |
| params: | |
| ref = "Homo_sapiens.GRCh37.dna.primary_assembly.fa", | |
| tmp_dir ="./" | |
| threads: | |
| 8 | |
| shell: | |
| """ | |
| bwa mem -R '@RG\\tID:SRR7526728\\tPL:ILLUMINA\\tSM:SRR7526728' -t 6 {params.ref} -M {input.R1_TRIM} {input.R2_TRIM} \\ | |
| | awk -v FS="\\t" -v OFS="\\t" '/^@/ {{print; next;}} {{ split($1, id, "_"); print $0,"RX:Z:"id[2];}}' \\ | |
| | fgbio SortBam -Djava.io.tmpdir={params.tmp_dir} -i /dev/stdin -s Queryname -o /dev/stdout \\ | |
| | fgbio SetMateInformation -o {output.bam} | |
| """ | |
| rule GroupReadsByUmi: | |
| input: | |
| bam = "{sample}_alignment.bam" | |
| output: | |
| bam = "{sample}_group.bam" | |
| params: | |
| tmp_dir ="./" | |
| shell: | |
| """ | |
| fgbio GroupReadsByUmi -Djava.io.tmpdir={params.tmp_dir} -i {input.bam} -s adjacency -o {output.bam} | |
| """ | |
| rule CallMolecularConsensusReads: | |
| input: | |
| bam = "{sample}_group.bam" | |
| output: | |
| bam = "{sample}_consensus.bam" | |
| params: | |
| tmp_dir ="./" | |
| shell: | |
| """ | |
| fgbio SortBam -Djava.io.tmpdir={params.tmp_dir} -s TemplateCoordinate -i {input.bam} -o /dev/stdout | fgbio CallMolecularConsensusReads -Djava.io.tmpdir={params.tmp_dir} -m 30 -M 1 -i /dev/stdin -o {output.bam} | |
| """ | |
| rule FilterConsensusReads: | |
| input: | |
| bam = "{sample}_consensus.bam" | |
| output: | |
| R1_consensus = "{sample}_R1_consensus.fastq.gz", | |
| R2_consensus = "{sample}_R2_consensus.fastq.gz" | |
| params: | |
| ref = "Homo_sapiens.GRCh37.dna.primary_assembly.fa", | |
| tmp_dir ="./" | |
| threads: | |
| 8 | |
| shell: | |
| """ | |
| fgbio FilterConsensusReads -Djava.io.tmpdir={params.tmp_dir} -i {input.bam} -o /dev/stdout -r {params.ref} -M 4 -N 1 -E 0.010 \\ | |
| | samtools sort -@ 6 -n \\ | |
| | samtools fastq -1 {output.R1_consensus} -2 {output.R2_consensus} - | |
| """ | |
| rule AlignConsenus: | |
| input: | |
| R1_consensus = "{sample}_R1_consensus.fastq.gz", | |
| R2_consensus = "{sample}_R2_consensus.fastq.gz" | |
| output: | |
| bam = "{sample}_realigned.bam", | |
| index = "{sample}_realigned.bam.bai" | |
| threads: | |
| 8 | |
| params: | |
| ref = "Homo_sapiens.GRCh37.dna.primary_assembly.fa" | |
| shell: | |
| """ | |
| bwa mem -R '@RG\\tID:SRR7526728\\tPL:ILLUMINA\\tSM:SRR7526728' -t 6 {params.ref} -M {input.R1_consensus} {input.R2_consensus}\\ | |
| | samtools sort -@6 -o {output.bam} - | |
| samtools index {output.bam} | |
| """ |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment